UK Judges Think US Makes It Too Hard To Get Patents, Lower Patentability Bar To Show How It's Done

from the you-mean-we-need-even-more? dept

The US patent system famously covers "anything under the sun that is made by man," and is generally regarded as being more "patent friendly" than other jurisdictions around the world. So it comes as something of a surprise to hear of the UK out-doing the US is this respect:
In a unanimous decision, the [UK Supreme] court determined that US utility doctrine creates an unduly high bar of patentability.
The reasoning – or rather lack of it – is just as surprising:
Thus, rather than requiring proof of specific, credible, and substantial utility at the time of filing, the UK court agreed that HGS's genetic sequence coding for Neutrokine-α was patentable even though there was no known use of the protein at the time the patent application was filing. The patent did not reveal how the protein "could be used to solve any particular problem" nor did it identify "any disease or condition which it could be used to diagnose or treat."
It's bad enough that naturally-occurring genomic sequences are being patented at all – sequences that certainly weren't invented by anyone. But allowing those patents without even requiring "proof of specific, credible, and substantial utility at the time of filing" is just insane: it will open the floodgates for even more speculative filings on DNA sequences in the hope that someone, someday will come up with a use for them. Except that if they did, they'd presumably be hit with a patent infringement suit. So how does that promote innovation?

The other danger, of course, is that the US judges might feel that their honor is a stake, and lower the US patentability bar even further to undercut those presumptuous British lords...

Follow me @glynmoody on Twitter or identi.ca, and on Google+


Reader Comments (rss)

(Flattened / Threaded)

  1.  
    icon
    Ima Fish (profile), Nov 14th, 2011 @ 1:40pm

    Ok I'm going to patent a piece of metal with holes drilled in it. I have no idea what use it'll have but my guess is that there are billions of dollars to be made once I start enforcing it against the manufacturing sector.

     

    reply to this | link to this | view in thread ]

  2.  
    icon
    BentFranklin (profile), Nov 14th, 2011 @ 1:49pm

    If all you're patenting is a gene sequence, shouldn't it should be copyrighted instead? Here's my sequence:

    GCTGCTATATAGCGCGCTATAGCTTATATACACCGGGGG
    CTCTATTAGATGCGCTGATATATATATCGCGCGTAGTCG
    ATGAT TATCGCGCGAGTAAATATATAAATTATATAGCTA
    TGCTAGCGGCGCCTATTACTGATATCTGGCGCCCTCTAT
    TCGGCATATATATCGCGCGTAGT CGATGATTATCGCGCG
    AGTAAATATATAAATTATATAGCTATGCTAGCGGCGCCT

    © 2011 BentFranklin

     

    reply to this | link to this | view in thread ]

  3.  
    identicon
    anonymous, Nov 14th, 2011 @ 1:51pm

    typical UK. when they dont understand something and cant do anything about it, do the exact opposite of what they should!

     

    reply to this | link to this | view in thread ]

  4.  
    identicon
    Anonymous Coward, Nov 14th, 2011 @ 1:57pm

    Re:

    "CGCCTATTACTGATA"

    You know how I can tell you're bold?

     

    reply to this | link to this | view in thread ]

  5.  
    icon
    timmaguire42 (profile), Nov 14th, 2011 @ 2:02pm

    Promoting Innovation is an American concept

    The public good is an American concept. European IP has a completely different philosophical foundation, which is why the U.S. didn't used and still shouldn't pay any attention to what Europe is doing when it decides what it will do.

    Bad as it may be, our system is better. And it shows in the statistics. They should be learning from us, not the other way around.

     

    reply to this | link to this | view in thread ]

  6.  
    icon
    Rikuo (profile), Nov 14th, 2011 @ 2:16pm

    In completely unrelated news, the term "prior art" is banned and punishable by death.

     

    reply to this | link to this | view in thread ]

  7.  
    identicon
    Anonymous Coward, Nov 14th, 2011 @ 2:17pm

    When a system gets to large to move, the only option is revolution.

    I for one welcome the "pirates" who will become revolutionaries when they win the copyright battle and it is scaled back to a reasonable term.

     

    reply to this | link to this | view in thread ]

  8.  
    identicon
    Anonymous Coward, Nov 14th, 2011 @ 2:20pm

    The U.K. is about to see a flood of perpetual motion patents :)

     

    reply to this | link to this | view in thread ]

  9.  
    identicon
    Anonymous Coward, Nov 14th, 2011 @ 2:24pm

    Re:

    Cavity resonance?
    particule filter, stream coherence filter?

    I could think of a few nonsensical names for that LoL

     

    reply to this | link to this | view in thread ]

  10.  
    identicon
    Bengie, Nov 14th, 2011 @ 2:25pm

    Re:

    Sounds like most governments, but I still find the UK reference funny because I hate being the only one picked on.

     

    reply to this | link to this | view in thread ]

  11.  
    identicon
    Bengie, Nov 14th, 2011 @ 2:30pm

    Re:

    even better

    1) Patent naturally occurring gene
    2) Don't know what to use it for
    3) ???
    4) Sue all of humanity for using it

     

    reply to this | link to this | view in thread ]

  12.  
    identicon
    Anonymous Coward, Nov 14th, 2011 @ 2:45pm

    Perhaps this is a good thing. If everybody were to rush out and file patents on everything without knowing if it would make money or not, then hopefully in the future those things that are useful won't be covered by patent because those patents will already be expired! =)

     

    reply to this | link to this | view in thread ]

  13.  
    icon
    A Guy (profile), Nov 14th, 2011 @ 3:24pm

    Re:

    My thought exactly +1

     

    reply to this | link to this | view in thread ]

  14.  
    identicon
    fogbugzd, Nov 14th, 2011 @ 3:28pm

    Response to: Anonymous Coward on Nov 14th, 2011 @ 2:45pm

    I have thought much the same.--this kind of action just starts the 17 year calendar early. But there are two problems with this line of reasoning. First, patent attorneys just ignore inconvenient prior art. Second, whoever does come up with an actual use will patent the new sliver of invention.

     

    reply to this | link to this | view in thread ]

  15.  
    icon
    Jesse (profile), Nov 14th, 2011 @ 3:36pm

    If my body naturally produces a patented gene sequence, can I be sued?

     

    reply to this | link to this | view in thread ]

  16.  
    icon
    Jesse (profile), Nov 14th, 2011 @ 3:37pm

    Re:

    More to the point, would I count as prior art?

     

    reply to this | link to this | view in thread ]

  17.  
    icon
    I_am_so_smrt (profile), Nov 14th, 2011 @ 3:37pm

    I just patented a time-machine, five minutes before you, guaranteed!

     

    reply to this | link to this | view in thread ]

  18.  
    icon
    The eejit (profile), Nov 14th, 2011 @ 3:54pm

    Re: Promoting Innovation is an American concept

    WE are learning from you - that's the problem. :p

     

    reply to this | link to this | view in thread ]

  19.  
    icon
    Jay (profile), Nov 14th, 2011 @ 3:56pm

    Re: Promoting Innovation is an American concept

    Copyright is still a French concept. We've taken it and engineered it for even worse results.

     

    reply to this | link to this | view in thread ]

  20.  
    identicon
    Anonymous Coward, Nov 14th, 2011 @ 4:22pm

    Re:

    Not really, with hundreds of thousands of patents being issued every year those people are really counting on the short term memory of others.

    People keep getting patents for things already invented or discovered, that is no accident.

    The patent system is just a big sham.

     

    reply to this | link to this | view in thread ]

  21.  
    icon
    A Guy (profile), Nov 15th, 2011 @ 1:26am

    The fact you can patent a human gene is completely asinine period, of course.

    It's not engineered (although it can be), it's a naturally occurring resource like oil, trees, and fish.

    The fact that you saw a species of fish or tree first doesn't mean you get a monopoly on it.

    The first person who saw some oil didn't get a patent on all petroleum products.

    It seems like a bad farce to me.

     

    reply to this | link to this | view in thread ]

  22.  
    identicon
    Anonymous Coward, Nov 15th, 2011 @ 5:25am

    Re: Re:

    On account of her bona ecaf?

     

    reply to this | link to this | view in thread ]

  23.  
    identicon
    Anonymous Coward, Nov 15th, 2011 @ 9:19am

    Re:

    I can do better than that. I'll write a random gene sequence generator and program it to automatically submit random gene sequences over to the USPTO for approval. I'll even license the software on the open market so that I can make even more money selling my new revolutionary software package.

     

    reply to this | link to this | view in thread ]

  24.  
    icon
    Richard (profile), Nov 15th, 2011 @ 12:24pm

    US v UK

    A pity - the UK patent office/courts are usually a bit better than this - but from time to time they also make blunders.

     

    reply to this | link to this | view in thread ]

  25.  
    icon
    Richard (profile), Nov 15th, 2011 @ 12:27pm

    Re: US v UK

    In fact the problem here stems not from the UK - but from the EPO/EPC. The supreme court was ruling about a European patent - not an actual UK one - and indeed the lower court had found the other way.

     

    reply to this | link to this | view in thread ]

  26.  
    identicon
    staff, Nov 16th, 2011 @ 7:15am

    another biased article

    "US Makes It Too Hard To Get Patents"

    Inventors agree.

    Masnick and his monkeys have an unreported conflict of interest-
    https://www.insightcommunity.com/cases.php?n=10&pg=1

    They sell blog filler and "insights" to major corporations including MS, HP, IBM etc. who just happen to be some of the world’s most frequent patent suit defendants. Obviously, he has failed to report his conflicts as any reputable reporter would. But then Masnick and his monkeys are not reporters. They are patent system saboteurs receiving funding from huge corporate infringers. They cannot be trusted and have no credibility. All they know about patents is they don’t have any.


    "patent reform"

    “This is not a patent reform bill” Senator Maria Cantwell (D-WA) complained, despite other democrats praising the overhaul. “This is a big corporation patent giveaway that tramples on the right of small inventors.”

    Senator Cantwell is right. Just because they call it “reform” doesn’t mean it is. The agents of banks, huge multinationals, and China are at it again trying to brain wash and bankrupt America.

    They should have called the bill the America STOPS Inventing Act or ASIA, because that’s where it is sending all our jobs.

    The patent bill is nothing less than another monumental federal giveaway for banks, huge multinationals, and China and an off shoring job killing nightmare for America. Even the leading patent expert in China has stated the bill will help them steal our inventions. Who are the supporters of this bill working for??

    Patent reform is a fraud on America. This bill will not do what they claim it will. What it will do is help large multinational corporations maintain their monopolies by robbing and killing their small entity and startup competitors (so it will do exactly what the large multinationals paid for) and with them the jobs they would have created. The bill will make it harder and more expensive for small firms to get and enforce their patents. Without patents we cant get funded. Yet small entities create the lion's share of new jobs. According to recent studies by the Kauffman Foundation and economists at the U.S. Census Bureau, “startups aren’t everything when it comes to job growth. They’re the only thing.” This bill is a wholesale slaughter of US jobs. Those wishing to help fight this bill should contact us as below.

    Small entities and inventors have been given far too little voice on this bill when one considers that they rely far more heavily on the patent system than do large firms who can control their markets by their size alone. The smaller the firm, the more they rely on patents -especially startups and individual inventors. Congress tinkering with patent law while gagging inventors is like a surgeon operating before examining the patient.

    Please see http://truereform.piausa.org/default.html for a different/opposing view on patent reform.
    http://docs.piausa.org/

     

    reply to this | link to this | view in thread ]


Add Your Comment

Have a Techdirt Account? Sign in now. Want one? Register here
Get Techdirt’s Daily Email
Save me a cookie
  • Note: A CRLF will be replaced by a break tag (<br>), all other allowable HTML will remain intact
  • Allowed HTML Tags: <b> <i> <a> <em> <br> <strong> <blockquote> <hr> <tt>
Follow Techdirt
Flattr rss rss
A word from our Sponsors...
Sponsored Resource
Essential Reading
Techdirt Reading List
Techdirt Insider Chat

A word from our Sponsors...
Recent Stories
A word from our Sponsors...

Close

Email This